Scientist Exchanges

JAPAN (NCI-JSPS) COOPERATIVE CANCER RESEARCH PROGRAM SCIENTIST EXCHANGE SUMMARY REPORT

(1) Ken Ohnishi
University of California, Los Angeles

DATE OF VISIT: 2003. 6. 4-2003. 8. 29

SUMMARY OF ACTIVITIES :
Objective
Radiotherapy or hyperthermia is now being developed for cancer therapy. The repair of DNA damages induced by radiation (possibly heat) is known to reduce the sensitivity of cancer cells to these stressors. Thus, the inhibition of DNA repair induces the increase in radiosensitivity (possibly heat sensitivity) of cancer cells. My research objectives during 3 month stay at UCLA are to acquire analysis methods of DNA damages and DNA repair system and further to discuss new strategies for cancer radiotherapy or hyperthermia. The final goal of my research is to make a new strategy that can be applied for cancer radiotherapy or hyperthermia based on the inhibition of DNA repair.
Summary
1. We analyzed the effects of radiation or heat on DNA repair-related proteins (NBS1 and p53) using Western blot.
2. We tried to establish small interference RNA (siRNA) method to suppress NBS1 expression.
3. We found that NBS1 is accumulated by not only radiation but also heat. This result suggests that NBS1 may contribute to DNA repair induced by heat.
4. We could establish the siRNA method. So we could suppress NBS1 expression selectively by siRNA method.
5. In future, we plan to examine the function of NBS1 in homologous recombination and nonhomologous end-joining using siRNA method.
6. Further, we plan to apply NBS1 siRNA expression plasmid to radiation cancer therapy or hyperthermia.


(2) Chikahide Masutani
Graduate School of Frontier Biosciences, Osaka University

SPONSOR AND HOST INSTITUTION:
University of Pittsburgh Cancer Institute
DATES OF VISIT: From 1/June/2003 To 29/August/2003

SUMMARY OF ACTIVITIES:
It is supposed that a DNA polymerase which has an ability to catalyze translesion synthesis is involved in the repair of intra-strand crosslinks of DNA. Recently, two novel human DNA polymerases, pol!!!and pol!!!have been identified in Dr. Rick Wood's laboratory. These are expected to be involved in the intra-strand crosslink repair, but little is known about their abilities as DNA polymerases. I participated to the group with pol!!!, which is the XPV gene product and catalyzes translesion synthesis past an UV-induced DNA Iesion, and DNA oligomers containing a site specific lesion. Using these, I have examined translesion synthesis abilities by pol!!!and pol!!!, and found that pol!!!has an ability to bypass the abasic site on the DNA. The finding strongly suggests that pol!!!has a unique DNA polymerase activity and can be a good candidate for the one involved in the intra-strand crosslink repair. In near future, the finding will be supported by works using substrates containing repair intermediates in vitro and using pol!!!-targeted cells.



(3) Yoshifumi Adachi
Department of Molecular Biology and Biochemistry, Shinshu University School of Medicine

SPONSOR AND HOST INSTITUTION:
The Cancer Institute of New Jersey, RWJMS, University of Medicine and Dentistry of New Jersey
DATES OF VISIT: From: August 1, 2003 To: August 30, 2003


SUMMARY OF ACTIVITIES:
To investigate the functions and biological significances of the lung cancer-associated RING finger protein, Topors/LUN, I and Dr. Rubin collaborated and carried out following research subjects.
1. Expression of Topors/LUN in various human cancer cells – We clarified that expression of Topors/ LUN was transcriptionally down-regulated in various cancer cells from patients.
2. Interactions of Topors/LUN, p53 and topoisomerase I – We confirmed that Topors/LUN formed a homodimer, and transactivated E-cadherin gene expression in cells.
3. Structural and functional analyses of Topors/LUN molecule – We clarified that the N-terminal region of Topors/LUN possessed both sequence-specific DNA binding activity followed by trans-activation of E-cadherin gene, and E3 ubiquitin ligase activity.
4. We subjected Topors/LUN-transfected cells to DNA microarray analysis to investigate Topors/LUN-responsive oncogenes and/or tumor-associated genes. (project ongoing)
5. We established micro-scale clinical diagnostic system ofTopors/LUN expression by using monospecific polyclonal antibody against human Topors/LUN.
6. I had a lecture entitled "Structure and Function of the Lung Cancer-associated RING Finger Protein, LUN" at auditorium of the Cancer Insti. of New Jersey, Univ. of Med. & Dent. New Jersey on 8/6/2003. "The RING Finger Protein LUN Is a Transcriptional Activator Upregulating E-cadherin Gene Expression" Gorrin, M. J., Chu, D., Oyanagi, H., Rajendra, R., Saleem, A., Wada, H., Rubin, E. H., Ueda, K., and Adachi, Y. (manuscript in preparation)



(5) Akira Tokumura
Faculty of Pharmaceutical Sciences, the University of Tokushima

SPONSOR AND HOST INSTITUTION:
Japan Society for the Promotion Sciences (JSPS)
The Cleveland Clinic Foundation
DATES OF VISIT: July 25-August 25, 2003

SUMMARY OF ACTIVITIES:
The aim of the proposed project is to clarify whether LPA Ievels in human serum and ascitic fluid are increased under some pathological situations in the female reproductive system. Dr. Xu, the Cleveland Clinic Foundation, has shown that incubation of ascitic fluids from several ovarian cancer cell patients resulted in the accumulation of LPA. During my visit, we were able to detect considerably high activity of lysophospholipase D in the ascitic fluid samples, and found a 100 kD protein band in the ascitic fluids was immunostained by Western blotting analysis with a monoclonal antibody for plasma lysophospholipase D/autotaxin.
I had five seminars [Cleveland Clinic Foundation, National Institute of Health, University of Texas M.D. Anderson Cancer Center (North and South) and University of Tennessee] on physiological and pathophysiological roles of LPA production by secretory lysophospholipase D in animal body fluids. Several times I joined to meetings in Drs. Xu, Stracke, Mills and Tigyi laboratories to discuss my current data on LPA and its producing enzymes as well as those presented by the host researchers and their coworkers. Furthermore, I talked about feature research projects with the host researchers .



(6) Masamitsu Honma, Ph.D.
National Institute of Health Sciences, Division of Genetics and Mutagenesis

SPONSOR AND HOST INSTITUTION
Dr. Andrew Grosovsky, University of California, Riverside
Dr. Akira Inoue, St. Jude Children Research Hospital
Dr. Martha Moore, National Center for Toxicological Research
DATE OF VISIT
From: June 7, 2003 To: August 7, 2003 (61 days)

SUMMARY OF ACTIVITIES:
I and Dr. Grosovsky make a collaborative study about the repair of DNA double strand breaks (DSBs), which is a main cause of radiation-inducing tumors. We recently developed human cell lines generating DSB at a specific site in the genome by introducing rare-cutting restriction enzyme site I-SceI. This is a best model for the study of DSBs repair in human cells. During staying his laboratory, I made some experiments to adjust the experimental conditions to effectively express the restriction enzyme vector. Finally, we decided to use an electroporation machine produced by Amaxa company to introduce the expression vector, because it can perform at highest efficiency. I defined best conditions to introduce expressing vectors, targeting vectors, and siRNAs into human cell lines. We can commonly use these conditions for further collaborative study. This is very important to compare the results mutually. During staying in CA Riverside, I made two seminars about DNA DSBs repair, interviews to several professors, and discussions with Dr. Grosovsky and lab stuffs for our collaborative study. Additionally, I visited UC Davis and UC Berkeley to talk with Dr Shibamoto and Drs Gold and Arnes, respectively about cancer risk management. I and Dr Inoue discussed about genetic instability and genetic factors influencing it. We will make a collaborative study to generate some knockdown cells associated with helicase activity. I made a seminar entitled "The fate of DSBs in human cells" in the St. Jude hospital and discuss with seven famous researchers about recent interests. I also collaborate with Dr. Moore concerning with mammalian gene mutation assay. We presented this collaborative work in the Annual Meeting of European Environmental Mutagen Society (Aug 24-28, 2003, Aberdeen in Scotland). I was mainly involved in making the poster for the presentation during staying her lab. I also gave a seminar entitled "A humanized in vitro genotoxicity test system" in her institute.
Publication:
M.M. Moore and M. Honma, Measurement of cytotoxicity in the mouse lymphoma assay (MLA): Implications for data comparison with in vitro cytogenetic assays. Abstract in European Environmental Mutagen Society 33rd Annual Meeting, p. 107, 2003.

You may submit additional information if related to the exchange program. In covering letter provide any additional comments or suggestions for the program.
I very appreciate the program for giving me the wonderful opportunity to study in some famous lab in the US. This experience must be helpful to understand our thinking and research attitudes mutually and fruitful for our future collaborative studies. If possible, I was happy if the program provided some research grant covering experimental expenses during staying.

MATERIALS & METHODS
A. Procedure of I-SCE Expression Experiments (From June 13)
1. Expression vector:
pCBAScel from Dr. Jasin through Dr. Takeda in Kyoto University. It was prepared in Masa's lab (2.4ug/ul)
2. Cell: TSCE5:
TK6 cell line having I-Scel site at intron 4 of tk gene. It was developed by Masa Honma.
3. Transfection (June 13):
a. 2X10&Mac246;7 cells from exponentially growing cells were taken, and washed by PBS twice, and suspended into 1.4ml PBS (5X10&Mac246;6 cells/0.7ml).
b. 0.7 ml (10&Mac246;7 cells) were transferred to cuvet with 50ul vector (120ug) and electroporated by the machine. As control, no DNA tranfection was also performed. Condition was 250V/960uF
Real: vector: 250V/31T
No vector (control): 250V/31T
4. After transfection and Measurement of endpoints
a. Transfected cells were transferred into 50 ml flesh medium of TS50 flasks.
b. At 3 days later (June 16), Cells were plated to isolate TFT-r mutants according to standard procedure.
c. At 14 days later (June 30), the normal growing mutants were checked, and then refeed TFT.
d. At 28 days later (July 14), the slowing growing mutants as well as total mutants were checked.

B . Procedure of RNA/DNA Interference Experiments (From June 30)
l. Target gene:
a. Hprt (TO isolate 6TG resistant clones)
Sens RNA (rHPRT347): AGCACUGAAUAGAAAUAGUGAUU (23nt)
Anti DNA: (dHPRT347): TCACTATTTCTATTCAGTGCTTT (23nt)
b. Konesin EG5 (TO check mitotic arrest or cell growth)
Sens RNA (rEG52263): CUGAAGACCUGAAGACAAUAAUU (23nt)
Anti DNA (dEG52263): TTATTGCTTTCAGGTCTTCAGTT (23nt)
2. Cell line
a. TSCE5(Human suspension cell line)
b. CHL-AL(CHL derived clone containing human chromosome 11)
c. HeLa cell (Human cancer cell line)
3. Preparation of RNA and DNA (June 30 and July l)
a. RNA: RNAs from Dharmacon were ACE protected (40 nmol=300ug). They were deprotected by manufacture's recommendation, and then dissolved into 200ul 10mM Tris-HCl(pH. 8.0) (200uM, 1.5ug/ul).
b. DNA: DNAs from Qiagen were dissolved into 250ul 200ul 10mM Tris-HCl (pH. 8.0) (200uM, 1.5ug/ul).
c. RNA/DNA hybrid: 75ul each solutions were mixed in a tube, heated by 94C for 5min followed by 53C for 3h, and then kept by room temperature overnight. (100uM, 1.5ug/ul).
4. Transfection (July 2)
a. TSCE5:
i. 1.4X10^7 cells from exponentially growing cells (6.3X10^5/ml) were taken, and washed by PBS twice, and suspended into 1.4 ml PBS (5X10^6 cells/0.7ml).
ii. 0.7 ml (5X10^6 cells) were transferred to cuvet with 40ul RNA/DNA hybrid (60ug) and electroporated by the machine. Condition was 300V/960uF
Real: HPRT: 300V/29T
EG5: 300V/29T
b. CHO-AL:
i. 4X10^7 cells from exponentially growing cells (6.3X10^5/ml) were taken, and washed by PBS twice, and suspended into 1.4 ml PBS (5X10^6 cells/0.7ml).
ii. 0.7 ml (5X10^6 cells) were transferred to cuvet with 40ul RNA/DNA hybrid (60ug) and electroporated by the machine. Condition was 300V/960uF
Real: HPRT: 300V/30T
EG5: 300V/30T
c. HeLa:
i. 1.0X10^7 cells from exponentially growing cells were taken, and washed by PBS twice, and suspended into 1.4 ml PBS (5X10^6 cells/O.7ml).
ii. 0.7 ml (4X10^6 cells) were transferred to curvet with 40ul RNA/DNA hybrid (60ug) and electroporated by the machine. Condition was 300V/500uF
Real: HPRT: 300V/16.2T
EG5: 300V/15.7T
5. After transfection and Measurement of endpoints
a. TSCE5:
i. Transfectcd cells were transferred into 50ml fresh medium in TS75 flasks.
ii. Cell concentrations were monitored 1 day, 3 day, and 5 day after transfection, and appropriately diluted.
iii. Mutant fraction of 6TG resistant clones were measured at 3rd and 5th day according to standard method
b. CHO-AL:
i. Half of transfected cells were transferred to 20ml fresh medium in TS75 flasks (For gene mutation assay).The other half of transfected cells were divided 3 TS25 flasks with 10ml fresh medium (For measuring cell growth).
ii. Cell concentrations of each flask were monitored I day, 3 day, and 5 day after transfection. Cells in flask were washed by PBS, treated with 0.25% Trypsin for 5min at 37C, added 5ml medium containing 100% serum, and then the concentrations were measured.
iii. Mutant fraction of 6TG resistant clones were measured at 5th day (At 3rd day, cells were harvested, . and replated into each 2 TS75 flasks. Total Cells: rHPRT: 9.14X10^6, rEG5: 9.18X10^6). To isolated 6TG-r mutants, 5X10^6 cells were plated in to 2 flasks of TS75 with 0.5ug/ml 6TG. For plating efficiency, I plated 100 cells into 2 TS25 flasks.
c. HeLa
i. The transfected cells were divided 4 TS25 flasks with 10ml fresh medium (For measuring cell growth).
ii. Cell concentrations of each flask were monitored I day, 3 day, and 5 day after transfection. Cells in flask were washed by PBS, treated with 0.25% Trypsin for 5min at 37C, added 5ml medium containing 10% serum, and then the concentrations were measured.

C. Electroporation by Amaxa (Future)
Cell: 5X10^6 – 10^7 (TK6)
DNA: 10 - 100 ug/ml
Solution: V
Condition: A30
*Other procedure should be followed by Amaxa's recommendation.

Industrial Genotoxicity and Regulatory Guidelines

P119 Measures of cytotoxicity in the Mouse Lymphoma Assay (MLA): Implications for data comparison with in vitro cytogenetic assays.
M.M. Moore¹ and M. Honma^2
1National Center for Toxicological Research, Food and Drug Administration. Jefferson, AR, USA. ²National Institute of Health Sciences, Division of Genetics and Mutagenesis, Tokyo, Japan.

The MLA and in vitro aberration analysis are considered to be acceptable altematives for in vitro mammalian cell evaluation of potential genotoxicity. The attainment of sufficient cytotoxicity is a key parameter for the proper conduct of these assays. The choice of chemical concentrations is based upon agreed required ranges for cytotoxicity. Unfortunately, these two assays do not use the same cytotoxicity measure.
Historically most in vitro mutation assays have used cloning efficiency immediately following treatment to assess cytotoxicity. The mouse lymphoma assay was originally developed using a new concept, the relative total growth (RTG). The RTG was developed to take into account the toxicity that occurs not only during treatment but also during the expression and mutant selection phases of the assay. While other measures (including plating efficiency immediately after treatment) have also been used with the MLA, recent discussions of the MLA Workgroup of the International Workshop for Genotoxicity Testing (lWGT) have resulted in a consensus that the RTG should be the standard cytotoxicity measure for the MLA. Cytogenetic assays generally do not include plating efficiency as a measure of cytotoxicity. In recent years, it has become the practice to use the relative cell count approximately 24 hrs after treatment.
Over the past several years, there has been a lively debate concerning the appropriate level of required cytotoxicity. While the MLA assay requires attaining 10-20% RTG to determine a chemical to be negative, the general consensus for in vitro cytogenetic assays is to require a 50% reduction in day 1 cell count. In order to evaluate the impact of the use of these different measures, we have graphically compared the day 1 relative cell growth and the RTG for a wide variety of chemicals analyzed in the MLA. The relationship between these two measures varies dramatically among the chemicals evaluated. On one extreme, 2-amino-hydroxyadenine-treated cultures showed no toxicity at day 1 (growing approximateiy 100% as well as the negative control) yet yielding RTG values as low as 1%. At the other extreme, trichloroacetic acid-treated cultures demonstrated day 1 relative growth and RTG values that were approximately the same. For the majority of the chemicals, cultures showing approximately 50% day 1 relative growth had RTG values from 40-10'/.. This analysis demonstrates that a "properly conducted" MLA and a "properiy conducted" in vitro cyiogenetic assay can easily involve testing over different concentration ranges. The magnitude of the difference will vary depending upon the chemical under evaluation. It is to be expected, therefore, that there will be situations where the results of the two assays will differ and that difference may be solely due to the concentrations of test chemicals used for the assays.

P120 Collaborative Assessment of the Yeast Genotoxicity Screen.
P M Collins¹, P A Weale¹, M G Barker², P Cahill² and R M Walmsley².
¹Sequani Limited, Ledbury, Herefordshire, UK, ²Dept of Biomolecular Sciences, UMIST. Manchester, UK.

The Yeast Genotoxicity Screen has been developed to provide a rapid genotoxicity assessment of compounds with interesting pharmacological or chemical properties. The objective of this collaborative study was to establish the reproducibility and reliability of the DNA damage reporter system in an independent laboratory. Yeast is an attractive model system for the detection and evaluation of carcinogens, as being eukaryotic, it is useful for the testing of highly bactericidal compounds, which preclude the use of the regulatory or screening Ames Test. The yeast has been genetically engineered (incorporation of reporter gene RAD54) to produce a fluorescent protein in proportion to the activation of their DNA repair systems. The harder its DNA repair systems work the brighter and stronger the fluorescence. The yeast cells, serial dilution of test article solutions, genotoxic (MMS) and cytotoxic (methanol) controls and diluent (2% DMSO) were manually mixed in 96-well microplates, then incubated overnight at 25 °C.
Cell density and fluorescence measurements provided quantitative measures of cytotoxicity (positive, weak or negative, proportional to proliferation, Iowered by toxic analytes) and genotoxicity (positive, weak or negative, proportional to fluorescence, increased by genotoxic analytes).
During the course of the study, the plating procedure was improved so increasing the number of test chemicals that could be plated per run, along with an improvement in the data capture program making it more user-friendly and the data easier to interpret.
The test was performed with rapid end-point determination, with good concordance of results, confirming the lack of interlaboratory and inter-personnel variation, therefore supporting the use of this screen as a useful and rapid genotoxicity assessment tool.
Considering the original plating procedure was the first trial outside of the developer’s laboratory, the results gained were pleasing.
The assay can be taught to skilled technicians within a single day, increasing its ease and frequency of use as a screening tool. Twelve test compounds can be set-up using the manual protocol by a single operator in 2/3 hours, which is a marked improvement over the standard regulatory Ames test or screen.




(8) NORIAKI OHUCHI
DIVISION OF SURGICAL ONCOLOGY, TOHOKU UNIVERSITY GRADUATE SCHOOL OF MEDICINE

SPONSOR AND HOST INSTITUTION:
APPLIED RESEARCH PROGRAM, DIVISION OF CANCER CONTROL AND PREVENTION, NCI, NIH
DATES OF VISIT: SEPTEMBER 6 TO SEPTEMBER 21

SUMMARY OF ACTIVITIES:
First, we exchanged updated information regarding the current status of breast cancer screening performed in Japan and United States including recent advances in breast cancer research. Then, we discussed a web-based program update database as a tool and resource for breast cancer screening performance and variations across the countries.
1) We designed questionnaires in order to request specific data, such as guidelines and policies, from Japan and USA. At this point, we met Drs. Stephen Taplin, Carrie Klabunde, Martin Brown to work out in details.
2) We compared the issues related to quality control for facilities based on the updated Mammography Quality Standard Act (MQSA) with the Japanese data obtained by the Imaging Unit Evaluation Subcommittee. The MQSA came effective as a national law by FDA, USA in 1999, whereas the facility qualification in Japan was established by the research group (Chief investigator, N. Ohuchi) in 2001, and is now conducted by the Central Committee of Quality Control for Mammography Screening in Japan.
3) We also compared quality control mechanism for interpreting physicians including education program, certification, and qualification system on the basis of national/regional mammography screening programs in two countries. The personnel qualification system, which has currently been established in Japan (voluntarily), has not been organized in USA.
4) The next step was to begin developing the preliminary instrument for collecting the necessary data, including recall rate, detection rate, sensitivity and specificity, TNM stage for subset analyses.
5) The final step was to agree on a structure and process for this effort and establish a web-based program update database as a tool and resource for breast cancer screening performance and variations across countries that participate in the International Breast Cancer Screening Network.
We had meetings with individual investigators on the topics listed in the attached sheet, indicating this program will be explored to future works, not only cancer control but also innovation in cancer imaging.
List publication resulting from study: Klabunde CN, Sancho-Garnier H, Taplin S, Thoresen S, Ohuchi N, Ballard-Barbash R. Quality assurance in follow-up and initial treatment for screening mammogrpahy programs in 22 countries. Int J Qual Health Care 2002. 14: 449-461.

I submit additional information related to the exchanged program.
Additional Information related to the exchanged program
Agenda and outcome for visit to NIH/NCI by Dr. Noriaki Ohuchi, Professor, Division of Surgical Oncology, Tohoku University School of Medicine, Country Representative (Japan),
September 6-20, 2003